{
  "url": "https://openlegislation.uk/eu-decision-2015-1554/annex-II/part-2/division-I/division-I.2/division-I.2.1",
  "json_url": "https://openlegislation.uk/eu-decision-2015-1554/annex-II/part-2/division-I/division-I.2/division-I.2.1.json",
  "legislation": "eudn/2015/1554",
  "legislation_title": "Commission Implementing Decision (EU) 2015/1554 of 11 September 2015 laying down rules for the application of Directive 2006/88/EC as regards requirements for surveillance and diagnostic methods (notified under document C(2015) 6188) (Text with EEA relevance)",
  "legislation_url": "https://openlegislation.uk/eu-decision-2015-1554",
  "path": "annex/II/part/2/division/I/division/I.2/division/I.2.1",
  "kind": "division",
  "number": "I.2.1",
  "heading": "qPCR for KHV detection",
  "text": "For qPCR detection of KHV, the following qPCR assay shall be used:\nForward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;\nReverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;\nand probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.\nCycling conditions: one cycle of 95 °C at 15 minutes, followed by 40 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.",
  "extent": "E+W+S+N.I.",
  "status": null,
  "version": "current",
  "annotations": [],
  "outstanding_effects": [],
  "provenance": {
    "source": "legislation.gov.uk",
    "source_url": "https://www.legislation.gov.uk/eudn/2015/1554/annex/II/part/2/division/I/division/I.2/division/I.2.1",
    "retrieved_at": "2026-11-01T15:14:14.330569+00:00"
  },
  "licence": "Open Government Licence v3.0",
  "licence_url": "https://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/",
  "attribution": "Contains public sector information licensed under the Open Government Licence v3.0. Source: legislation.gov.uk, The National Archives."
}