# Commission Implementing Decision (EU) 2015/1554 of 11 September 2015 laying down rules for the application of Directive 2006/88/EC as regards requirements for surveillance and diagnostic methods (notified under document C(2015) 6188) (Text with EEA relevance), Division I.2.1: qPCR for KHV detection

Extent: E+W+S+N.I.

For qPCR detection of KHV, the following qPCR assay shall be used:
Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;
Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;
and probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.
Cycling conditions: one cycle of 95 °C at 15 minutes, followed by 40 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.

---
Source: https://www.legislation.gov.uk/eudn/2015/1554/annex/II/part/2/division/I/division/I.2/division/I.2.1 (the official version)
Page: https://openlegislation.uk/eu-decision-2015-1554/annex-II/part-2/division-I/division-I.2/division-I.2.1
Contains public sector information licensed under the Open Government Licence v3.0. Source: legislation.gov.uk, The National Archives.