# Commission Implementing Decision (EU) 2015/1554 of 11 September 2015 laying down rules for the application of Directive 2006/88/EC as regards requirements for surveillance and diagnostic methods (notified under document C(2015) 6188) (Text with EEA relevance), Division II.2.1: qPCR for KHV detection

Extent: E+W+S+N.I.

The qPCR described as follows shall be used:
Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;
Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;
and probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.
Cycling conditions: one cycle of 95 °C at 15 minutes, followed by 50 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds.
The results of the qPCR may vary depending on the conditions under which it is performed, namely the thermal protocols might need optimisation, depending on the thermal cycler in use. Furthermore, false-positive results may occur because of false primer annealing or laboratory contamination. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.

---
Source: https://www.legislation.gov.uk/eudn/2015/1554/annex/II/part/2/division/II/division/II.2/division/II.2.1 (the official version)
Page: https://openlegislation.uk/eu-decision-2015-1554/annex-II/part-2/division-II/division-II.2/division-II.2.1
Contains public sector information licensed under the Open Government Licence v3.0. Source: legislation.gov.uk, The National Archives.