# Commission Implementing Decision (EU) 2015/1554 of 11 September 2015 laying down rules for the application of Directive 2006/88/EC as regards requirements for surveillance and diagnostic methods (notified under document C(2015) 6188) (Text with EEA relevance), Division II.1.3: RT-qPCR for ISAV detection

Extent: E+W+S+N.I.

The use of RT-qPCR may increase specificity and probably also sensitivity. The method can be performed more rapidly as no gel electrophoresis step is required and it reduces the risk of cross contamination as it is possible to estimate the amount of viral genomic RNA within the sample tube. A drawback of the RT-qPCR assay is that it is often not possible to sequence amplified products. However, if there is doubt on the specificity of the amplified product, another ISAV specific assay must be run to verify the result.
The assay described in this point, which is an assay that target segment 8, shall be used. This assay shall cover isolates from Europe and North America. The one-step method shall be used where possible, because the one tube assay minimises the risk of cross-contamination.
Forward primer: 5′- CTACACAGCAGGATGCAGATGT -3′;
Reverse primer: 5′- CAGGATGCCGGAAGTCGAT -3′;
and probe: 5′-FAM- CATCGTCGCTGCAGTTC – MGBNFQ-3′.
Negative template controls and positive controls shall be included on each plate run. Cycling conditions: one cycle of 50 °C for 30 minutes, one cycle of 95 °C for 15 minutes, 40 cycles of 94 °C for 15 seconds, 60 °C for 60 seconds; it shall be adjusted if necessary. Other RT-PCR or RT-qPCR versions of proven similar efficacy may be used instead.

---
Source: https://www.legislation.gov.uk/eudn/2015/1554/annex/II/part/3/division/II/division/II.1/division/II.1.3 (the official version)
Page: https://openlegislation.uk/eu-decision-2015-1554/annex-II/part-3/division-II/division-II.1/division-II.1.3
Contains public sector information licensed under the Open Government Licence v3.0. Source: legislation.gov.uk, The National Archives.