Division I.2.1 qPCR for KHV detection

For qPCR detection of KHV, the following qPCR assay shall be used:

• Forward primer (KHV-86f): 5′- GACGCCGGAGACCTTGTG -3′;

• Reverse primer (KHV-163r): 5′- CGGGTTCTTATTTTTGTCCTTGTT -3′;

• and probe (KHV-109p): 5′-FAM- CTTCCTCTGCTCGGCGAGCACG -3′.

Cycling conditions: one cycle of 95 °C at 15 minutes, followed by 40 cycles of 94 °C at 15 seconds and 60 °C for 60 seconds. Negative template controls and positive controls shall be included on each plate run. However, other qPCR versions of proven similar efficacy may be used instead.